Identification of the underlying mechanism of the c.192G>C mutation ...
RTPCR Ex3 fwd. DJ-1 with exon 3. 5'- cgagctgggattaaggtcac -3'. RTPCR Ex3 rev. DJ-1 ... Oxidized DJ-1 inhibits p53 by sequestering p53 from promoters in a DNA ...
RTPCR Ex3 fwd. DJ-1 with exon 3. 5'- cgagctgggattaaggtcac -3'. RTPCR Ex3 rev. DJ-1 ... Oxidized DJ-1 inhibits p53 by sequestering p53 from promoters in a DNA ...